Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.058637 |
Chromosome: | chromosome 12 |
Location: | 2350079 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508000 | TIC40 | (1 of 5) IPR006636 - Heat shock chaperonin-binding; Putative chloroplast enveloppe protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGAAATACACGAATAGTCGCAATGGATGATAGAGAAGGAGGCAGATG |
Internal bar code: | AGTAACTAATGGAACAATTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4692 |
LEAP-Seq percent confirming: | 65.7143 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATTCGCAGACCCCAACAGA |
Suggested primer 2: | GTATCGCACAACGCATGGTC |