Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.058685 |
Chromosome: | chromosome 6 |
Location: | 578790 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g253250 | MADS2 | (1 of 1) PTHR11945:SF221 - SERUM RESPONSE FACTOR | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGTTCCCCTCGCAAGGGAAAAGTGGGCTGAGCCCACGCCACGTCTT |
Internal bar code: | TCTTAGGGGTACTGTCACTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 763 |
LEAP-Seq percent confirming: | 42.8571 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGGCCATATCTGGGGACT |
Suggested primer 2: | CACATACCACCCCTCTGCTG |