| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058700 |
| Chromosome: | chromosome 13 |
| Location: | 1410170 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571950 | (1 of 1) 2.1.1.104 - Caffeoyl-CoA O-methyltransferase / Trans-caffeoyl-CoA 3-O-methyltransferase | 3'UTR | |
| Cre13.g572000 | TPM1,UPM2,SUMT2,COBA | Putative tetrapyrrole methylase; (1 of 1) 2.1.1.198 - 16S rRNA (cytidine(1402)-2'-O)-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCTGCCGCTTTTACCAGCCAGCTCCATTGTCTCCAATCTCCATCGC |
| Internal bar code: | CGCTGGCCACGATTAGCAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3543 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGAGGTGAGCTCCAGGG |
| Suggested primer 2: | GGGTAGCATCTAGTGGACGC |