| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.058812 |
| Chromosome: | chromosome 16 |
| Location: | 5389899 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683100 | (1 of 239) IPR016024 - Armadillo-type fold | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAATTCAGATTCTACATTGGAAACTCACCATGATTTCTACTGTTATGA |
| Internal bar code: | GAGTATCCTATTTTATCCTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1886 |
| LEAP-Seq percent confirming: | 97.8723 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGCTCCACGCGTGAACAA |
| Suggested primer 2: | CGTTGTCATGGGTTCGGGTA |