| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.058857 |
| Chromosome: | chromosome 12 |
| Location: | 1066506 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g491600 | PTB1 | (1 of 14) PTHR11101//PTHR11101:SF58 - PHOSPHATE TRANSPORTER // SUBFAMILY NOT NAMED; Sodium/phosphate symporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGCATACGGTATGAACACCAACGGCCACTGGCGACGCCACCGCACGA |
| Internal bar code: | GTGATCTGGCGGGGTAGCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1277 |
| LEAP-Seq percent confirming: | 68.9655 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATAGCCAGGGGACGCATG |
| Suggested primer 2: | GCATACATCCGGGGGTAGTG |