Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.058863 |
Chromosome: | chromosome 12 |
Location: | 8256499 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g551500 | DNJ14,MDJ1A | (1 of 1) PTHR24078:SF207 - PROTEIN DNJ-19; Mitochondrial DnaJ-like protein 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGCCCCACAAACTCATCGCACACGCGCACCATGAATGAGATCCGCAG |
Internal bar code: | AACGTCATCTGTTTGCATGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 156 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGTGCAGTAAGCTTGGAG |
Suggested primer 2: | CTCCCTTCCACCCCATTTCC |