| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.058866 |
| Chromosome: | chromosome 17 |
| Location: | 3152474 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720750 | TRF4 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGGCTATGTTTTTAGTTGTCACATAACCCAAGCATAAATCACCTCCAA |
| Internal bar code: | TTCAGTAGCCTTTTAAGTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1417 |
| LEAP-Seq percent confirming: | 88.4615 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACAGAGCTTGCACTGCAG |
| Suggested primer 2: | CGTCCGAGTCCGACAATAGG |