| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.058889 |
| Chromosome: | chromosome 2 |
| Location: | 1970363 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088050 | RPP30,XRP30 | Ribonuclease MRP subunit P30; (1 of 1) K03539 - ribonuclease P/MRP protein subunit RPP1 (RPP1, RPP30) | 5'UTR |
| Cre02.g088100 | (1 of 173) IPR029058 - Alpha/Beta hydrolase fold | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTACTGGCGGCGGCTAGCAACACATGCAAACTATTGCGGCAAACCCGG |
| Internal bar code: | TGTGTTCAGTAGGAGCTACTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1599 |
| LEAP-Seq percent confirming: | 88.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCCCCACTCAGTCTCATC |
| Suggested primer 2: | GACACCAACGAACACACGTG |