| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.058907 |
| Chromosome: | chromosome 4 |
| Location: | 2253349 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220387 | CYP770A1 | (1 of 10) IPR001128//IPR002401 - Cytochrome P450 // Cytochrome P450, E-class, group I; Cytochrome P45. Previously annotated as CYP77A1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCAGGGGCTGCGGTTTCCCTACATCCCGGTTCATCCAATCTCATCC |
| Internal bar code: | CTATTACATCCGGTGCTGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 5.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGGGGACGTCATAGGAG |
| Suggested primer 2: | TGCGTGTGTGTGGGTTACTT |