| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.058954 |
| Chromosome: | chromosome 4 |
| Location: | 3637677 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228675 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron | |
| lncRNA_TCONS_00096852 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTGCCCCCTCCCCGCCCCCGCTTGCTAGGGCACGTCCCAGCATTCCA |
| Internal bar code: | AGCAATGGCTATGTCGTCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 494 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGCAACAACTGGGAACG |
| Suggested primer 2: | TGGTCCAACGCATGTTACGA |