| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059044 |
| Chromosome: | chromosome 6 |
| Location: | 8438261 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308350 | PPA1,PPP26 | Serine/threonine protein phosphatase 6 homolog, metallophosphoesterase; (1 of 1) K15498 - serine/threonine-protein phosphatase 6 catalytic subunit [EC:3.1.3.16] (PPP6C) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGGCGACAGTGAGCGTTGTATCTTCAGACACGCATCCTGGACCAGACA |
| Internal bar code: | TTGTAATTCCCGCTCACGTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3133 |
| LEAP-Seq percent confirming: | 92.9577 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGGCTTCCTTGCTAGTAA |
| Suggested primer 2: | GTGGGTGTGGCAATGTTGAC |