| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.059091 |
| Chromosome: | chromosome 1 |
| Location: | 6826643 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048950 | PYR5 | Uridine 5'- monophosphate synthase; (1 of 1) 2.4.2.10//4.1.1.23 - Orotate phosphoribosyltransferase / Orotidylic acid phosphorylase // Orotidine-5'-phosphate decarboxylase / Uridine 5'-monophosphate synthase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGCACGAGGGCATTCGGAGCCCTTCATTCTTTTATGCACGGCGTCAA |
| Internal bar code: | GTAGGGGTTAGAATTAGGTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1047 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATCTCCGCTTGCGTCATG |
| Suggested primer 2: | GCCCATACTTGTCCAACCCA |