| Insertion cassette: | CIB2 | 
| Side of cassette: | 3' | 
| Strand: | + | 
| Strain: | CLIP2.059105 | 
| Chromosome: | chromosome 6 | 
| Location: | 953072 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre06.g256420 | (1 of 1) K15196 - transcription factor IIIB 90 kDa subunit (BRF1, GTF3B) | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCGTGGTCCCTGCACTCTTGGTCCCTGCACGGGTCGTGCACAATCAA | 
| Internal bar code: | GTTCCTCTCGTTATTGCACCGC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3056 | 
| LEAP-Seq percent confirming: | 100.0 | 
| LEAP-Seq n confirming: | 20 | 
| LEAP-Seq n nonconfirming: | 0 | 
| LEAP-Seq n unique pos: | 20 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCGCGGATGATTTGGAGC | 
| Suggested primer 2: | CCAGGGAGGGCAAGTTAGTG |