| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059119 |
| Chromosome: | chromosome 12 |
| Location: | 4311488 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518772 | (1 of 2) K12893 - splicing factor, arginine/serine-rich 4/5/6 (SFRS4_5_6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAACGTGGCTGGCATGTGGCGTTGAAAGGCACAAGGAGTGAGTTGATG |
| Internal bar code: | TCAGTGAAAGTGCGCGTCATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3472 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCGTTAGCTCGCATACCT |
| Suggested primer 2: | CGGTGAAATGAGGACAACGC |