| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059144 |
| Chromosome: | chromosome 17 |
| Location: | 2392992 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g714250 | DLC5,DLX2,ODA-LC5 | Flagellar Outer Arm Dynein light chain 5, thioredoxin; (1 of 12) 1.6.5.4 - Monodehydroascorbate reductase (NADH) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCCCTCCTAGCAACGTGCAATCAACTTGAGCGCGCAGGGCTGCCAGC |
| Internal bar code: | TATTGATAATCGGGCTGACTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 37.5 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACGCGTACACAGAACTT |
| Suggested primer 2: | TTGCACCCGGTATGTGTACC |