| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059258 |
| Chromosome: | chromosome 2 |
| Location: | 2796237 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g094250 | (1 of 2) K13354 - solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17 (SLC25A17, PMP34) | 5'UTR | |
| Cre02.g094300 | FUO1 | (1 of 1) 1.5.5.1 - Electron-transferring-flavoprotein dehydrogenase / ETF-ubiquinone oxidoreductase; Electron transfer flavoprotein-ubiquinone oxidoreductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGCAATACGCCTGGTGCGGGGGTTGAACCCGCAGTGTCAAGGGGAAAT |
| Internal bar code: | TCTTATGCACATGATAAATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2680 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGATTCGTCGGGAACTCG |
| Suggested primer 2: | TCAAGGACGAAGGCGAGTTC |