Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.059267 |
Chromosome: | chromosome 13 |
Location: | 1258003 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g570600 | CTR1 | CTR type copper ion transporter; (1 of 2) K14686 - solute carrier family 31 (copper transporter), member 1 (SLC31A1, CTR1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGGGCGAAGAGCACAGCGTGCGGCAGCGGCCAGGTAGGGGGTGGGGG |
Internal bar code: | AGTAGCTATGCAAGCTAGTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2205 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAAGGGCATGACACGCTTA |
Suggested primer 2: | TGGCAGTCGAAGGGGTTAAC |