Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.059311 |
Chromosome: | chromosome 2 |
Location: | 6007743 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g118650 | PHC47 | Pherophorin-chlamydomonas homolog 47; (1 of 71) PF12499 - Pherophorin (DUF3707) | outside_mRNA |
lncRNA_TCONS_00232151 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTAAGGCGGGTACTGGCGAGTGCGGGCGGGCGCGGGCACGGGCGCGGC |
Internal bar code: | GCTCGTTCGTATTGGAGTGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2734 |
LEAP-Seq percent confirming: | 75.3623 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGATACTACGCGTGCCAGG |
Suggested primer 2: | GGACAGCGCTCCAAGTAAGT |