Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.059362 |
Chromosome: | chromosome 13 |
Location: | 1557575 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g572950 | E2F2,E2FR1 | Transcription factor, E2F and DP-related; (1 of 2) PTHR12548//PTHR12548:SF9 - TRANSCRIPTION FACTOR DP // TRANSCRIPTION FACTOR DP | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGCCCTGCACGGACGCGTCGCCGTCACTCGAGATGAAGCCAAACGA |
Internal bar code: | CTAGGCAACGACCAGGAGGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1474 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGACACGTGCTGCAACAAC |
Suggested primer 2: | CAACTCCAGGTTGCTGCAAC |