| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.059397 |
| Chromosome: | chromosome 6 |
| Location: | 8626327 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309900 | MST2 | Similar to Mastigoneme protein; (1 of 4) IPR009030//IPR011641 - Insulin-like growth factor binding protein, N-terminal // Tyrosine-protein kinase ephrin type A/B receptor-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGCGATGCGCGTCTGAGGCTTACTTGTGGGAGGGAGTGGGACCGCGG |
| Internal bar code: | TCGGGCCGTGTGTCTGCCTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1310 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGCTCGGTCATGATCGTG |
| Suggested primer 2: | ATTGTTAGTGGTGCGGTCGT |