| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.059407 |
| Chromosome: | chromosome 7 |
| Location: | 841435 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318500 | CYA8 | Putative very-long-chain fatty acid condensing enzyme; (1 of 5) 2.3.1.199 - Very-long-chain 3-oxoacyl-CoA synthase / Very-long-chain beta-ketoacyl-CoA synthase | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTTTGTCCTGCTCCCCTCCTCCTAGTCTGGTACTTCCCCGGCTCTTT |
| Internal bar code: | GCGAAGGCGTGGGGGAACGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1803 |
| LEAP-Seq percent confirming: | 68.75 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACTGAGAACCGGCCATTG |
| Suggested primer 2: | CCGTGGTTGACAGCAGTTTG |