| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.059424 |
| Chromosome: | chromosome 16 |
| Location: | 2427341 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g659900 | 5'UTR | ||
| Cre16.g659950 | PRPS5 | Chloroplast Ribosomal Protein S5; (1 of 2) K02988 - small subunit ribosomal protein S5 (RP-S5, MRPS5, rpsE) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACGCATGATAACCGGGCTCGGCACAATCGACCCATGATGCATGGCGC |
| Internal bar code: | GCCTTTGATGCCAAAGAAATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3488 |
| LEAP-Seq percent confirming: | 98.9583 |
| LEAP-Seq n confirming: | 95 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGATCTGCTTCATCGCCTC |
| Suggested primer 2: | TCTTGCAGCCCTTGATCAGG |