Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.059449 |
Chromosome: | chromosome 2 |
Location: | 3168185 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g096601 | (1 of 1) IPR001440//IPR013026//IPR019734 - Tetratricopeptide repeat 1 // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGGTTGTCAGCCATGGCGCGTTTCAGCGCGTCCTGTGACACATGGCC |
Internal bar code: | GATAGAATTTTTGTTTGGAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 866 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGCAAACACACATACACA |
Suggested primer 2: | CCCTTCCCTACCCTACCGAA |