Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.059492 |
Chromosome: | chromosome 7 |
Location: | 6042207 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g800867 | (1 of 3) PF09011 - HMG-box domain (HMG_box_2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCCTATCAGTCCGCATATGACATGTGATCCTCGGACCAGAGTGCCG |
Internal bar code: | CGAGTCTGAAGTAAGGTACTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3060 |
LEAP-Seq percent confirming: | 76.0 |
LEAP-Seq n confirming: | 76 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGACCTACAAGCCCCAT |
Suggested primer 2: | CTGCTACATGCTGTGGGTGA |