| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.059509 |
| Chromosome: | chromosome 17 |
| Location: | 913830 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702750 | SDR27 | (1 of 1) 1.1.1.102 - 3-dehydrosphinganine reductase / KTS reductase; Short-chain dehydrogenase/reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCCGCAAGGCGCACGTCATGCTATTCTTACACACCCTCCGTCATCCT |
| Internal bar code: | TCGGAGCATCATCGCATTTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 237 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGATGCAGTGTGTGTGTTT |
| Suggested primer 2: | AACGCGCGGATCCTGATTAT |