Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.059512 |
Chromosome: | chromosome 3 |
Location: | 1673171 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g153050 | RWP1 | (1 of 1) IPR000104//IPR003035 - Antifreeze protein, type I // RWP-RK domain; RWP-RK transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGGGAGAGAGAAAGCGCTGCGGTCCAGGTGGCCTGGGGCCTGGGAGA |
Internal bar code: | TCTTACAGATGTGTCAACGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1861 |
LEAP-Seq percent confirming: | 61.1111 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAAGTCTTGACCAGGCGCT |
Suggested primer 2: | GTACAAAGCGCTGCACAACA |