Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.059544 |
Chromosome: | chromosome 16 |
Location: | 4949362 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g686500 | (1 of 1) PF03767 - HAD superfamily, subfamily IIIB (Acid phosphatase) (Acid_phosphat_B) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAAACTAATGTTACAGCCTCTTCTGGTACCGCATTCGTCTGTAATCG |
Internal bar code: | GGCTTTCTAGGGGCTACGACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1894 |
LEAP-Seq percent confirming: | 84.375 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGTTGGGCATGTGTTGT |
Suggested primer 2: | GACTGTGACGGGCAAAGGTA |