| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.059585 |
| Chromosome: | chromosome 10 |
| Location: | 137783 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418600 | RLS3 | RegA/Rls-like protein; (1 of 10) IPR010919 - SAND domain-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGTCTGCCCGCCACACAATCATTGCCCCCGCTCCAACCTCCATGCTT |
| Internal bar code: | GAGTAGTGGACGTAGTCCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4148 |
| LEAP-Seq percent confirming: | 98.6487 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACAGGAAACAACCGGAAC |
| Suggested primer 2: | ACACGAACGCACAACACATG |