Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.059636 |
Chromosome: | chromosome 8 |
Location: | 2829445 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g373878 | RAA13 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; putative protein kinase associated with psaA trans-splicing complex | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACCAGACCGCTATCTTGCCCAAGCCTGACTCATTTTACCATGCAGTGA |
Internal bar code: | CAGATGATCAGTGTAGGGTTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1341 |
LEAP-Seq percent confirming: | 92.0 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCTTGAAGCCACCCTCTG |
Suggested primer 2: | CCAAACGCAATCAACACCGT |