| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.059637 |
| Chromosome: | chromosome 11 |
| Location: | 1290671 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467699 | SEC1 | Vesicle trafficking protein Sec1; (1 of 1) K15292 - syntaxin-binding protein 1 (STXBP1, MUNC18-1) | 3'UTR |
| Cre11.g467701 | 3'UTR | ||
| Cre11.g467702 | MRPS3,uS3m | (1 of 3) PF00189 - Ribosomal protein S3, C-terminal domain (Ribosomal_S3_C); Mitochondrial ribosomal protein S3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATGGCCGCCGTGGCCCGACAAAAGATGGACTGATGACGTGAAACCCAT |
| Internal bar code: | TTGAAATATCCATGGCTGACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2650 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGCGTGTAGATTCCAAAG |
| Suggested primer 2: | AAGCCATTGCCGGTTTTGAC |