| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.059656 |
| Chromosome: | chromosome 2 |
| Location: | 2006254 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088350 | SNR3 | (1 of 6) PF09335 - SNARE associated Golgi protein (SNARE_assoc); SNARE associated Golgi protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAACAACAGGAACCCCTTCATCCGTCTCCCAGGAGGGGGCTCTCGTGGA |
| Internal bar code: | AGGGTTTATGACTGGATGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2185 |
| LEAP-Seq percent confirming: | 81.4815 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCATTCACTCCGCATTCG |
| Suggested primer 2: | AAGGTCCGAGAGCAACCTTG |