Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.059662 |
Chromosome: | chromosome 2 |
Location: | 2990603 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095450 | FKB16F,FKB9,FKB16-6 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516:SF145 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP42 | 3'UTR |
Cre02.g095500 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACAGGCCCGCGCCGAGATTAAGCCCATGCTTTTGTCGCGCCTGTTTG |
Internal bar code: | GGTATATAGTATTTAGAAGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 964 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCATTGCTTCCTTGTGCTT |
Suggested primer 2: | CCTGCTTGAATCTGCCTGGA |