| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.059669 |
| Chromosome: | chromosome 3 |
| Location: | 6819440 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197350 | CDC5 | (1 of 1) K12860 - pre-mRNA-splicing factor CDC5/CEF1 (CDC5L, CDC5, CEF1); Cell Division Cycle 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCAAACCAAAATGCCCACTCTCGCCATACCGCCCGACACCCCACCG |
| Internal bar code: | CGTGCTAAAGGTCCAAAGATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1758 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCACGTTCCTGAACCTCTC |
| Suggested primer 2: | CATGCCCCATCAAGGACTGT |