Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.059684 |
Chromosome: | chromosome 16 |
Location: | 210927 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g694800 | GT90F31,GT90-31 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 31 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCTTGTAACTGCCGTGCTGGAAGTCCCAAACCCGTGAAAGTGGGGG |
Internal bar code: | TATATTGGCACACCTTTGGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1229 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTAGAACGAGTAGCCCGA |
Suggested primer 2: | AGTGTTGCGAGTACACAGGG |