Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.059709 |
Chromosome: | chromosome 7 |
Location: | 1803513 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325728 | (1 of 5) PF12681 - Glyoxalase-like domain (Glyoxalase_2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATAATGCGGACGCCCAGCGGTTTCAGCGCCGCTCCGTACCAGGCCTTG |
Internal bar code: | CGTGATTCATAGGGTGTGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2169 |
LEAP-Seq percent confirming: | 38.4615 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCACCCGAACCCTATTCAA |
Suggested primer 2: | CAAACACAGCACATCGCACA |