Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.059754 |
Chromosome: | chromosome 7 |
Location: | 5417631 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g350550 | EEP6 | (1 of 3) PTHR22748//PTHR22748:SF4 - AP ENDONUCLEASE // DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE 2; putative exodeoxyribonuclease III | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTTACCTTACATGGCATCGCCGGCCTGCAGCGCCGGATACAAAGTGC |
Internal bar code: | TGAGATAAATAGAACATCCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 381 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCACCTTGGACACCCTTC |
Suggested primer 2: | CGCAATGTCGAGGCAAACAA |