| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059764 |
| Chromosome: | chromosome 6 |
| Location: | 7495235 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300900 | GLE1 | Nucleoporin GLE1; (1 of 1) K18723 - nucleoporin GLE1 (GLE1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTACCCCCCCCCCCCCCCTCTTTCAGTCGCCACTTCTGTACCAGCCTC |
| Internal bar code: | TTTTAGCCTGCACCACCCATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1433 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGTGACCCCCAAAGCAA |
| Suggested primer 2: | CATGCACCAATAGGCGAACG |