| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.059765 |
| Chromosome: | chromosome 7 |
| Location: | 5948863 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354450 | CYP743B1,CYP22,CYP743B3 | Cytochrome P450, CYP197 superfamily; (1 of 19) 1.14.14.1 - Unspecific monooxygenase / Xenobiotic monooxygenase | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCGGCGGTCAGAAGGCAGGCGGGCCGCAGCGAATATGGTACGGTGCG |
| Internal bar code: | CCCGTGGGATCAAATCTATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1308 |
| LEAP-Seq percent confirming: | 95.3488 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGTGCCCCAACATACTGC |
| Suggested primer 2: | GCAGTAGCAGACCCAGATCC |