| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.059771 |
| Chromosome: | chromosome 2 |
| Location: | 1191260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081400 | BCA1 | Branched chain amino acid aminotransferase; (1 of 1) 2.6.1.88 - Methionine transaminase / Methionine-oxo-acid transaminase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGATGGAACATGGCAAGGGGCAGGAAAGCGTAGTCCCGATGTGTGTGG |
| Internal bar code: | TTAGCCTTTCCATTCGGTCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2807 |
| LEAP-Seq percent confirming: | 94.5578 |
| LEAP-Seq n confirming: | 139 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 147 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGCGTGAAACAGCTGTC |
| Suggested primer 2: | AGATGGAGGGGCTCATTCCT |