| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.059772 |
| Chromosome: | chromosome 11 |
| Location: | 1474990 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g469350 | TTL12 | (1 of 14) PF03133 - Tubulin-tyrosine ligase family (TTL); Putative tubulin tyrosine ligase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAAGCTGTGCTGGCGCCGCGCCCGGAAACCTGTTAAACTCTCTAGGC |
| Internal bar code: | ATAGAGGAGAACAAAGGACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2318 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTGTCATGCAGCGATTG |
| Suggested primer 2: | CATTGCTCACCGGGGTACTT |