| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.059774 |
| Chromosome: | chromosome 3 |
| Location: | 1772051 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g153800 | GPI8,PIGK1,PIGK | (1 of 1) K05290 - phosphatidylinositol glycan, class K (PIGK); GPI transamidase subunit K | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGGCTTTTCGGGGTATTCCCGCGCTTACAGGCTTCTCTGTACAGTTAT |
| Internal bar code: | CTTGCTTTTAATTACGCTTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1223 |
| LEAP-Seq percent confirming: | 9.30233 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGGGACTGGTTCACGAG |
| Suggested primer 2: | ATACAACTGCTCCACCAGGC |