| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.059819 |
| Chromosome: | chromosome 4 |
| Location: | 456671 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217921 | COPB1 | Beta subunit of COP-I complex; (1 of 1) K17301 - coatomer, subunit beta (COPB1, SEC26) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCCATCCAGACATACGTAGGCAGGGCACCCTAACGCCTCCTCCGTG |
| Internal bar code: | AAGCAGATTAGAATCCAAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1526 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACGTGTCGGTGGAGAAGA |
| Suggested primer 2: | AACCAAGTTTGCACGATGCC |