| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.059820 |
| Chromosome: | chromosome 15 |
| Location: | 354123 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g638101 | (1 of 1) PF03692 - Putative zinc- or iron-chelating domain (CxxCxxCC) | 5'UTR | |
| Cre15.g801684 | (1 of 1) PF12051 - Protein of unknown function (DUF3533) (DUF3533) | 5'UTR | |
| lncRNA_TCONS_00212696 | 5'UTR | ||
| lncRNA_TCONS_00213367 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAACTCGCTCAGCATTGCCCGAACATTCTCCGCCGCTTGGAATGGAC |
| Internal bar code: | GCGTTTTAATAGGATAGGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTTTGGGCTTGCAATAA |
| Suggested primer 2: | GGAGAAGCAGTAGCCAAGCA |