| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.059872 |
| Chromosome: | chromosome 3 |
| Location: | 6355998 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192400 | (1 of 1) IPR013769 - Band 3 cytoplasmic domain | 3'UTR_intron | |
| Cre03.g192450 | CYA3 | Adenylate cyclase; (1 of 70) 4.6.1.1 - Adenylate cyclase / ATP pyrophosphate-lyase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTAACATGGCCCTTTAATCCTCCACACCGCAACATTTATTTGCAGGAC |
| Internal bar code: | CTTAAAAATACCCATTCCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1990 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAGGAGACATTCGATCCG |
| Suggested primer 2: | CCGCCTCTACCTTTCGATCC |