Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.059877 |
Chromosome: | chromosome 12 |
Location: | 2685157 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g505200 | HEL51 | (1 of 1) K14777 - ATP-dependent RNA helicase DDX47/RRP3 [EC:3.6.4.13] (DDX47, RRP3); DEAD/DEAH box helicase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATAGGAATTACAGGCGTTTCGCGCAGGCGATGCAATGATTGACGTGT |
Internal bar code: | GTGTCTCCGGTAGTAGTATTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1329 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTGCTTACGGAAGGTGTC |
Suggested primer 2: | CTGATGAGCTGGCTCGGTAG |