| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.059897 |
| Chromosome: | chromosome 3 |
| Location: | 2636468 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160550 | MTP4 | Metal Transport Protein 4; (1 of 3) PTHR11562:SF21 - PROTEIN R02F11.3, ISOFORM B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTTGACGCGCATAGGCTACCAGCGGCCCCGCTTGCTGCGGTATTTC |
| Internal bar code: | AATCCGTAGTGGATTGATGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1345 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGAAGCCACTGCCTAGC |
| Suggested primer 2: | CAACCCGGAACCCTAACTCC |