| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.059937 |
| Chromosome: | chromosome 2 |
| Location: | 4040518 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g103050 | (1 of 26) IPR013026//IPR019734 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | 3'UTR | |
| Cre02.g103100 | SDR5 | (1 of 1) K11165 - dehydrogenase/reductase SDR family member 7 (DHRS7); Short-chain dehydrogenase/reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGCGTCTCATGTATACGGCAGCCAATCAGCCATGACCGGCAGGCTGG |
| Internal bar code: | TTGTTGCTGAAAGTATTGGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2183 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAGAGAGCGAGTGGGTGC |
| Suggested primer 2: | TGCAGGCTATATCTGGCAGC |