Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.059965 |
Chromosome: | chromosome 6 |
Location: | 8326039 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g307300 | ANT2 | ADP/ATP carrier protein, mitochondrial; (1 of 3) K05863 - solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 (SLC25A4S, ANT) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAGCAGGAGGCGCTCTCAAGGCAAGAGCTACCCCCACTCACACGACT |
Internal bar code: | GAGCAATTCGAATGCAGCACTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 759 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGATTGTTCCAGAGGGTGCC |
Suggested primer 2: | ATATTGCTGGGGGTTTGGGG |