| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.060035 |
| Chromosome: | chromosome 9 |
| Location: | 1361313 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400312 | (1 of 5) IPR001680//IPR011047//IPR017986 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTTTGGAGACTAGTTGTGACCTAGAGTCGGGATCGCGAGGAGGCCTC |
| Internal bar code: | CTCTTTCGCTGGTGACTACCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5534 |
| LEAP-Seq percent confirming: | 77.451 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 102 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTACTAGAGGCCTCGGTT |
| Suggested primer 2: | CCAAAAGAGAACGCGCCAAA |