| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.060068 |
| Chromosome: | chromosome 2 |
| Location: | 41839 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073200 | THD1 | putative threonine dehydratase and component psaA trans-splicing sub complex II; (1 of 1) K01754 - threonine dehydratase (E4.3.1.19, ilvA, tdcB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGGCCCGGGTTTGGGGCGGGTTTTGTCCGAATTCCTATGGAGAAGCC |
| Internal bar code: | ATATGGCAGGGTCATCGGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 853 |
| LEAP-Seq percent confirming: | 64.7059 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAATTGCACCACTTTGGCA |
| Suggested primer 2: | CAATGATGCATGGCGGGAAG |